D"
The teaching that a base animal changed in the past - mutated to parent many new unique and different species is evolution – a creature changes its form into an different species
God made animals with variety and diversify built into each kind.
YEP and after the flood a parent of the KIND evolved into all the species of that KINDR" do you have any idea what evolution is?
CCGTAGCTGGTACTATACCGACTGCTGCAACTAAGC This is a pile of letters of information on the DNA strand.
Evolution is the process of changing this information
into something brand new and of meaningful advantage for the organism.
Suppose this strand is the protein for a nose....
The protein code begins from
TATA, hence here is the protein codon code
CCGTAGCTGGTAC
TATACCGACTGCTGCAACTAAGCFor different folding and a new nose protein structure the new evolved code must be
CCGTAGCTGGTAC
TATACCGAGAGCTATGACTTTGC etc
However this is
just the protein structure.
Next there must be code changes to the development of this protein in 3D space? What code is this?
DO we assume it's the same codon as protein codes, or different reading of the DNA altogether? Nobody knows
No body can read the rest of the DNA for decision makings, where to build the new protein, when not to, which road does the new protein travel down on, where not to travel down on, where does the protein get attached, when not to get attached, where is the code for making decisions, None of this additional code has been discovered, and we are talking about trillions of letters of more code, not just the code for proteins.
A new structure does not begin with just bricks, bolts, nails and reo. You need further instructions for development.
Than you need further brand new code for decision making, looping statements and much much more.
Information decisions cannot arise naturally, such a notion is completely absurd.
D"
So are you suggesting that a Bear evolved downwards into a Raccoon?R" who says the bear and the raccoon are types of the same kind?
dogs, dingoes, wolf and the fox, might be. (I say might be) One would have to investigate the genome of the kind genetically.
All these animals look more of less like dogs.
The panda, the koala and the grizzly are all bears, from the same kind?
D"
So is your evolutionary spoiling still happening - are there new and different species continuing to appear today? If not?R" I would imagine today too many varieties of DNA inside kinds are being rapidly lost thus not much adaptation is happening today. What animal can't adapt, dies -> instinct.
God foreknew the variation for each animal kind as necessary and reprogrammed that change into the genes to be switched on or off as necessary. Our pineal gland function for example is switched off since Adam's sinned?
There is no evidence of naturalism gaining brand new information from any natural means, other than a designer designing information, hence evolution on any level does not exist.
A divine designer pre-programmed the variations in the DNA to begin with from creation. As animals carried that information, some switched on genes, other switched off some genes, eventually over time, mutations spoiled that code locking the animal into a permanent form we see today. So I doubt many animals have code left for more adaptation change, but some might still.
D"
why is it necessary to omit evidence or misrepresent the evidenceR" Creation people do not omit evidence or misrepresent the evidence?
R" Can you listen to Don Patton without getting upset my his so called childish remarks? Can you see the empirical evidence he presents? I don't think you are willing to listen to anything I present to you....
youtu.be/edkqd9BknJoDinosaur Figurines, Fact or Fraud Dr. Don Patton
goes for an hour, Don presents empirical evidence.
ncse.ngo/paluxy-man-creationist-piltdownEvidence against the Paluxy footprints
youtu.be/J7F4CGmtQHADon Patton shows Paluxy evidence, in just 4 minute video.
Why do people mock empirical evidence ?
Please take the time to listen to all the videos.
D"
KINDS are necessary because the ark is too smallR" No. Average size animals as juveniles is about the same as a sheep. How many sheep like volumes could you fit onto the ark? DO you have any idea?
I have seen blurry pictures of the real ark and the replica Ron Wyatt found. The real ark is much bigger say about 1100 metres long, broken in three pieces by glacier ice.
D"
Not only did they evolve and change into new and different species – they did it super fast because it all had to happen 6000 years agoR" There you go again, use a term that is meaningless
"evolve"
D"
The teaching that a base animal changed in the past -
R" who said anything about base animal changing to another base animal?
Dogs are dogs, wolves look like dogs, so do foxes and dingoes look like dogs...duh
D"
the flood a parent of the KIND evolved into all the species of that KINDR" Absolutely NO. not correct. "
evolved" no.
DO you understand the term you use? Apparently not.
D"
So are you suggesting that a Bear evolved downwards into a Raccoon?R" not sure about bears and raccoons? Are they the same kind?
Wolves, dogs, foxes and dingoes are more or less canine dogs of the dog kind.
D"
Correct – you say God created KINDS and then the KINDS evolved into all the species we have todayR" Again NO. Do you any any idea what the term "evolved" means ? Apparently no. Not a clue. See my explanation in this post above.
The doggy kind changed as programmed to adapt, into other dog features and dog functions. Sadly the mutations and UV radiation spoiled that pre-programmed code locking some features of dog into species that are nor fixed, so the wolf doesn't sexually mate with the fox anymore, but the wolf and the fox are dogs, of the doggy kind.
D
"changed into all the species we have todayR" take the different finches we have today? What makes them different species of finches? I do not see why the need to label finch kind birds into dozens of new species. A bigger beak, a small beak, etc, more or less a finch.
D"
Then show me Ken Hamms FACTs
Instead - all you have done is offer opinions from other CreationistR" I already spoke of Ken Ham, back in 1980
I didn't like Ken Ham.
I present Creation people I like, is that a problem to you?
D"
then the species change into a new speciesR" How does a species change into a new species using natural means? Not possible, unless the code is already fully there for that change. And I wouldn't call it a new species, just a bird of variety.
D"
It is nothing more than another Robert word gameR" I thought you are a science person? Surely you study biology at the DNA level? Don't you understand my words? Have you viewed any of my videos? Obviously not.
Do you have any serious discussions on what evolution is and means, and I mean at the deepest levels?
DNA code we think and assume is based on 4 letters, information technology does not arise from random changes and natural selection of beneficial behaviors, not possible.
Your
evolved term is a myth.
God did not create thousands of species from the beginning of creation. Not necessary. He only needed to create basic kinds and allow the animals to fill and multiple, make new variations based on the genes already in their bodies.
For example the canine creature can look like dogs, wolves and foxes and wolverines.
But this creature canine is just a canine with variety. Science confuses us with additional meaningless labels. Scripture labels insects with 4 legs, not as we science do with 6, so science has spoiled the labels Scripture uses. Not Scripture's fault, but Science is the cause of confusion.
D"
Roberts version – all the animals were not destroyed in the flood – only mankindR" No. The breath of life is administrated by the HS in all the animals too. Man is not special as you claim in this theme. Cows and dogs and dinos also have
the HS administrating the breath of living in these animals too.
D
"Truth - in a way I agree - not all life was destroyed in the FloodR Scripture say all living things died, OK maybe some fish survived, maybe whales did too, maybe insects outside the ark too. We can only speculate the past remember?
D"
Truth did dinos walk with man – yes before the FloodR" You cannot support this idea
and remain true to evolutionary ideas at the same time.
You cannot be lukewarm, either hot or cold, not a mixture of truth and error. This is a Bible principle on the notions of science. You cannot add "evolve" into "creation".
D"
Creationist claim of dinos on the Ark only make the size issue worse for themR" A juvenile dino was the size of a sheep, only a few were larger, how big do you suppose the ark was? Don Patton estimates the ark could house 200 million sheep sized animals, if I remember his video? Would you watch it if I showed you the link? But he assumes the wrong size. If we go on 1100 metres by 200 metres and say 50 metres high, and assume the third was for storage and waste, this is 10 million cubic metres of space. So roughly 6 million metres cube of space for animals, assume each animal takes up 1 cubic metres of space that is space for 3 million land animal pairs. I suggest you watch Don Patton's video, and than triple the estimate he offers.
youtu.be/ZIW2c1sxEcASome science estimate 1 million species, but we don't need fish on ark, so we get to just 7,000 land animals.
So we have enough space for over 3 million land animal species as well as kinds.
And I have only filled the ark 50% or so.
D"
Creationist do not say The Base KIND evolved into all the KINDS of their KINDR" Why must you hijack God's way and force it mean something else?
Science speaks of the Cambrian explosion of animals changing rapidly? This is simply a rapid diversity of animals already programmed to change and adapt. the code for this was already written in the genome. Science re-writes God's way, leaving God out of it, assuming naturalism did it all. This is what you are doing.
Natural selection is another hijack of God's way too. I will term this natural adaption, those animals able to cope with changes in their world adapt, those who can't adapt die. A bear walked into Australia and found nothing to eat but gum leaves, so some survived, and the enzymes changed to cope with eating gum leaves. A bear in Asian found only bamboo to eat and survives on bamboo. A bear in Canada find its hard to eat leaves only, so turns more or less on 90% berries and 10% fish, a bit more adaption is required, plus lots of sleeping in winter.
Natural adaption is possible as long as the code for that is preserved and still in tact. Science could study the code for this in the grizzly the panda and the koala, find a pair of kolas with Canada bear genes still intact, and slowly over a period of 400 years get the koala to change from Australia to living in Canada. Is this possible? Yes if we do the things I suggest. But science has not yet read anything like the full DNA code, not even 1% of the code is read as yet, we have trillions of code to still find.
D"
Why don’t the two agree? And why is wont Creationist publish their guidelines?R" Because funding research to disprove evolution would cause hatred in that religion. Why doesn't the Turkey Gov allow us to dig up Noah's ark on the mountain? Because such evidence would end "evolution".
D"
Where did the energy come from in the first place to create the flood?
Then – where did the energy/heat go that was produced in the process?
Energy cannot be created or destroyed – only translated or transmuted!R" Conjecture and theories at best . I cannot answer your heat problems.
D
"keep the heat problem in the back of your mind because it is relevant to all other sciencesR" heat is a byproduct of the work of God, and God does what He wants as He wants. Who is to say God uses naturalism all the time to do His work? That is an assumption. For example a miracle is a process that is supernatural.
Shalom